'what is the mRNA strand ATGGCCTACGGTCTAGTTTAG'?

We found this answers

complementary strand of DNA that results ... TACCGGATGCCAGATCAAATC Complementary DNA #1 ATGGCCTACGGTCTAGTTTAG DNA ... mRNA #3 AUG GAC AAU UCG AUG ... - Read more

What is the base sequence of the complementary strand of mRNA for the DNA strand with the following sequence? ... one ATGGCCTACGGTCTAGTTTAG. second . - Read more

Discussion about this question


'what is the mRNA strand ATGGCCTACGGTCTAGTTTAG'? resources

SHOW MORE ....